Review



celltracker 50m lentiviral double- barcoded library  (Cellecta Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Cellecta Inc celltracker 50m lentiviral double- barcoded library
    Celltracker 50m Lentiviral Double Barcoded Library, supplied by Cellecta Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+50m+lentiviral+double-barcoded+library/lentiviral+barcode+library/pm38478609-387-10-16
    Average 90 stars, based on 1 article reviews
    celltracker 50m lentiviral double- barcoded library - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Pre-existing Functional Heterogeneity of Tumorigenic Compartment as the Origin of Chemoresistance in Pancreatic Tumors.
    Article Snippet: Barcodes of each read were then compared with the library (CellTracker 50M Lentiviral Double-Barcoded Library, Cellecta), allowing for mismatches.

    Article Title: Pre-existing Functional Heterogeneity of Tumorigenic Compartment as the Origin of Chemoresistance in Pancreatic Tumors.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies mouse anti-gH2AX abcam Cat#ab26350; RRID: AB_470861 rabbit anti-RAD51 abcam Cat#ab63801; RRID: AB_1142428 HLA-ABC BD Biosciences Cat#562006; RRID: AB_10894395 mouse H-2Kd histocompatibility complex antigens BD Biosciences Cat#553577; RRID: AB_394935 fluorescent anti-gH2AX antibody BD Biosciences Cat#560447; RRID: AB_1645414 Bacterial and Virus Strains pRSI16 Cellecta BC13X13-V Biological Samples Patient-derived xenografts (PDX) This paper UTMDACC N/A Chemicals, Peptides, and Recombinant Proteins gemcitabine Selleckchem S1714 AZD-6738 Selleckchem S7693 gemcitabine Syd Labs 211876 BEZ235 AbMole BioScience M1671 AZD6244 AbMole BioScience M1661 Critical Commercial Assays CellTracker 50M Lentiviral Double-Barcoded Library Cellecta BC13X13-V Deposited Data NGS data This paper PRJEB27735 Experimental Models: Cell Lines PDAC PDX 1 cell line This paper UTMDACC N/A PDAC PDX 2 cell line This paper UTMDACC N/A Isolated clonal cell lines This paper N/A Experimental Models: Organisms/Strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ Jackson Laboratory 005557 NSG Oligonucleotides 13K_R2 AGTAGCGTGAAGAGCAGAGAA This paper N/A FHTS3 TCGGATTCAAGCAAAAGACGGCATA This paper N/A

    Recombinant:

    Article Title: Pre-existing Functional Heterogeneity of Tumorigenic Compartment as the Origin of Chemoresistance in Pancreatic Tumors.
    Article Snippet: Barcodes of each read were then compared with the library (CellTracker 50M Lentiviral Double-Barcoded Library, Cellecta), allowing for mismatches.

    Article Title: Pre-existing Functional Heterogeneity of Tumorigenic Compartment as the Origin of Chemoresistance in Pancreatic Tumors.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies mouse anti-gH2AX abcam Cat#ab26350; RRID: AB_470861 rabbit anti-RAD51 abcam Cat#ab63801; RRID: AB_1142428 HLA-ABC BD Biosciences Cat#562006; RRID: AB_10894395 mouse H-2Kd histocompatibility complex antigens BD Biosciences Cat#553577; RRID: AB_394935 fluorescent anti-gH2AX antibody BD Biosciences Cat#560447; RRID: AB_1645414 Bacterial and Virus Strains pRSI16 Cellecta BC13X13-V Biological Samples Patient-derived xenografts (PDX) This paper UTMDACC N/A Chemicals, Peptides, and Recombinant Proteins gemcitabine Selleckchem S1714 AZD-6738 Selleckchem S7693 gemcitabine Syd Labs 211876 BEZ235 AbMole BioScience M1671 AZD6244 AbMole BioScience M1661 Critical Commercial Assays CellTracker 50M Lentiviral Double-Barcoded Library Cellecta BC13X13-V Deposited Data NGS data This paper PRJEB27735 Experimental Models: Cell Lines PDAC PDX 1 cell line This paper UTMDACC N/A PDAC PDX 2 cell line This paper UTMDACC N/A Isolated clonal cell lines This paper N/A Experimental Models: Organisms/Strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ Jackson Laboratory 005557 NSG Oligonucleotides 13K_R2 AGTAGCGTGAAGAGCAGAGAA This paper N/A FHTS3 TCGGATTCAAGCAAAAGACGGCATA This paper N/A

    Next-Generation Sequencing:

    Article Title: Pre-existing Functional Heterogeneity of Tumorigenic Compartment as the Origin of Chemoresistance in Pancreatic Tumors.
    Article Snippet: Barcodes of each read were then compared with the library (CellTracker 50M Lentiviral Double-Barcoded Library, Cellecta), allowing for mismatches.

    Article Title: Pre-existing Functional Heterogeneity of Tumorigenic Compartment as the Origin of Chemoresistance in Pancreatic Tumors.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies mouse anti-gH2AX abcam Cat#ab26350; RRID: AB_470861 rabbit anti-RAD51 abcam Cat#ab63801; RRID: AB_1142428 HLA-ABC BD Biosciences Cat#562006; RRID: AB_10894395 mouse H-2Kd histocompatibility complex antigens BD Biosciences Cat#553577; RRID: AB_394935 fluorescent anti-gH2AX antibody BD Biosciences Cat#560447; RRID: AB_1645414 Bacterial and Virus Strains pRSI16 Cellecta BC13X13-V Biological Samples Patient-derived xenografts (PDX) This paper UTMDACC N/A Chemicals, Peptides, and Recombinant Proteins gemcitabine Selleckchem S1714 AZD-6738 Selleckchem S7693 gemcitabine Syd Labs 211876 BEZ235 AbMole BioScience M1671 AZD6244 AbMole BioScience M1661 Critical Commercial Assays CellTracker 50M Lentiviral Double-Barcoded Library Cellecta BC13X13-V Deposited Data NGS data This paper PRJEB27735 Experimental Models: Cell Lines PDAC PDX 1 cell line This paper UTMDACC N/A PDAC PDX 2 cell line This paper UTMDACC N/A Isolated clonal cell lines This paper N/A Experimental Models: Organisms/Strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ Jackson Laboratory 005557 NSG Oligonucleotides 13K_R2 AGTAGCGTGAAGAGCAGAGAA This paper N/A FHTS3 TCGGATTCAAGCAAAAGACGGCATA This paper N/A

    Isolation:

    Article Title: Pre-existing Functional Heterogeneity of Tumorigenic Compartment as the Origin of Chemoresistance in Pancreatic Tumors.
    Article Snippet: Barcodes of each read were then compared with the library (CellTracker 50M Lentiviral Double-Barcoded Library, Cellecta), allowing for mismatches.

    Article Title: Pre-existing Functional Heterogeneity of Tumorigenic Compartment as the Origin of Chemoresistance in Pancreatic Tumors.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies mouse anti-gH2AX abcam Cat#ab26350; RRID: AB_470861 rabbit anti-RAD51 abcam Cat#ab63801; RRID: AB_1142428 HLA-ABC BD Biosciences Cat#562006; RRID: AB_10894395 mouse H-2Kd histocompatibility complex antigens BD Biosciences Cat#553577; RRID: AB_394935 fluorescent anti-gH2AX antibody BD Biosciences Cat#560447; RRID: AB_1645414 Bacterial and Virus Strains pRSI16 Cellecta BC13X13-V Biological Samples Patient-derived xenografts (PDX) This paper UTMDACC N/A Chemicals, Peptides, and Recombinant Proteins gemcitabine Selleckchem S1714 AZD-6738 Selleckchem S7693 gemcitabine Syd Labs 211876 BEZ235 AbMole BioScience M1671 AZD6244 AbMole BioScience M1661 Critical Commercial Assays CellTracker 50M Lentiviral Double-Barcoded Library Cellecta BC13X13-V Deposited Data NGS data This paper PRJEB27735 Experimental Models: Cell Lines PDAC PDX 1 cell line This paper UTMDACC N/A PDAC PDX 2 cell line This paper UTMDACC N/A Isolated clonal cell lines This paper N/A Experimental Models: Organisms/Strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ Jackson Laboratory 005557 NSG Oligonucleotides 13K_R2 AGTAGCGTGAAGAGCAGAGAA This paper N/A FHTS3 TCGGATTCAAGCAAAAGACGGCATA This paper N/A



    Similar Products

    90
    Cellecta Inc celltracker 50m lentiviral double- barcoded library
    Celltracker 50m Lentiviral Double Barcoded Library, supplied by Cellecta Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+50m+lentiviral+double-barcoded+library/lentiviral+barcode+library/pm38478609-387-10-16
    Average 90 stars, based on 1 article reviews
    celltracker 50m lentiviral double- barcoded library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Cellecta Inc celltracker 50m lentiviral double-barcoded library
    Celltracker 50m Lentiviral Double Barcoded Library, supplied by Cellecta Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/celltracker+50m+lentiviral+double-barcoded+library/lentiviral+barcode+library/pm30726735-234-0-8
    Average 90 stars, based on 1 article reviews
    celltracker 50m lentiviral double-barcoded library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results